Thứ tư, 21/10/2020 | 22:38

Thứ tư, 21/10/2020 | 22:38

Bài báo khoa học

Cập nhật 10:35 ngày 29/09/2020

Nghiên cứu khả năng sinh tổng hợp Cellobiose Dehydrogenase từ một số loài nấm phân lập ở rừng mưa phía Bắc Việt Nam

TÓM TẮT
Enzyme từ nấm được biết đến có khả năng thủy phân hiệu quả vật liệu giàu lignocellulose. Quá trình phân hủy này cần nhiều enzyme tham gia hoạt động phối hợp để thủy phân cấu trúc polymer. Trong số đó, một số enzyme oxi hóa cần thiết như lignin peroxidase, mangan peroxidase hay laccase... Cellobiose dehydrogenase (CDH) là enzyme ngoại bào được sinh tổng hợp ở nhiều loài nấm khác nhau, chúng được phát hiện đầu tiên vào năm 1974 bởi Westermark trong nấm thối trắng Trametes verscolorPhanerochaete chrysosporium. Vai trò sinh học của CDH đã được chứng minh tham gia vào sự phân hủy các polymer như cellulose, hemicellulose và lignin bằng cách tạo ra gốc hydroxyl thông qua phản ứng Fenton. CDH có các đặc tính xúc tác và điện hóa sinh học độc đáo đã được sử dụng trong cảm biến sinh học để phát hiện cellodextrin, maltose, lactose và các hợp chất diphenol hoặc trong các ứng dụng y sinh như sản xuất axít lactobionic. Vì thế, CDH là một thành phần quan trọng của hệ thống enzyme ngoại bào để phân giải lignocellulose. Trong nghiên cứu này, 47 chủng nấm phân lập tại 2 vùng sinh thái (rừng quốc gia Cúc Phương, Mường Phăng) được sàng lọc hoạt tính enzyme CDH. Trong đó, 33 chủng biểu hiện hoạt tính CDH từ 8,89 đến 74,4 U/L khi phát triển trên môi trường rắn, cơ chất rơm. Chủng thể hiện hoạt tính cao nhất được xác định là Coprinellusaureogranulatus MPG14 với hoạt độ CDH đạt 77,4 U/L trên môi trường cơ bản và 237,4 U/L ở điều kiện thích hợp: bổ sung nguồn carbon từ α-cellulose (20 g/L), nguồn nitrogen từ pepton (5 g/L) sau 12 ngày lên men dịch thể, ở 30oC, pH 5,5, trong điều kiện nuôi lắc 200 v/ph. Như vậy, chủng nấm trên có tiềm năng để khai thác enzyme CDH ứng dụng trong việc tiền xử lý các vật liệu giàu lignocellulose.
Từ khóa: cellobiose dehydrogenase, cellodextrin, mannodextrin, fenton, lignocellulose degrading enzymes
ĐẶT VẤN ĐỀ
Sinh vật phân hủy lignocellulose đóng một vai trò quan trọng trong việc duy trì vòng tuần hoàn carbon nhờ khả năng chuyển hóa hiệu quả các vật liệu giàu lignocellulose bởi hệ enzyme thủy phân và oxi hóa. Chúng chịu trách nhiệm chính trong việc phá vỡ cấu trúc phức tạp của lignocellulose (Hetti, et al., 2004). Trong số các sinh vật phân hủy lignocellulose, các loài nấm được biết là có hệ xúc tác sinh học hiệu quả nhất. Việt Nam là một trong những quốc gia có đa dạng sinh học cao trên thế giới với trên 72.000 loài thực vật bậc cao, trong đó có khoảng 2.250 loài nấm (Roberts, Evans, 2011). Enzyme từ nấm lớn được biết đến có khả năng thủy phân hiệu quả vật liệu giàu lignocellulose. Để phân hủy lignocellulose, ngoài hệ enzyme ngoại bào cellulase quá trình thủy phân lignocellulose còn cần các enzyme thủy phân khác bao gồm esterase (feruloyl esterase, acetyl xylan esterase), chúng hoạt động phối hợp với các enzyme tấn công mạch chính (cellulase/xylanase) và mạch nhánh của cấu trúc polymer này. Tuy nhiên, cấu trúc phức tạp của lignocellulose trong thành tế bào làm hạn chế hoạt động của nhiều loại enzyme (Peters, et al., 2007). Do vậy, quá trình phân hủy lignocellulose còn cần các enzyme oxi hóa như lignin/mangan peroxidase, laccase, cellobiose dehydrogenase hoạt động phối hợp để thủy phân cấu trúc polymer (Sachslehner, et al.,1997).
Cellobiose dehydrogenase (EC 1.1.99.18) là một enzyme ngoại bào được sinh tổng hợp bởi
các loài nấm khác nhau, được phát hiện lần đâu tiên vào năm 1974 bởi Westermark (Westermark, Eriksson, 1974) . Nhiều enzyme CDH từ các loài nấm khác nhau đã được quan tâm nghiên cứu, điển hình như: Sclerotium rolfsii (Baminger, et al., 2001), Termitomyces clypeatus (Tanima, et al., 2008). Enzyme CDH oxi hóa các cellodextrin hòa tan, mannodextrin và lactose hiệu quả thành các lacton tương ứng theo cơ chế riêng biệt bằng cách sử dụng các chất nhận điện tử bao gồm quinone, phenoxyradicals, Fe3+, Cu2+ và ion triiodide (Zamocky, 2006; Wood, 1992). Các kết quả gần đây chứng minh vai trò sinh học của CDH trong việc hỗ trợ cơ chế tạo gốc hydroxyl bằng cách khử Fe3+ thành Fe2+ và O2 thành H2O2, nhờ đó có thể làm biến đổi cellulose, hemicellulose và lignin thông qua phản ứng Fenton (Henriksson, et al., 2000).
Vì thế, enzyme CDH là một thành phần quan trọng của hệ thống enzyme ngoại bào để phân giải lignocellulose (Morpeth, 1985). Các đặc tính xúc tác và điện hóa sinh học độc đáo của CDH đã được sử dụng trong cảm biến sinh học để phát hiện cellodextrins, maltose, lactose, các hợp chất diphenolic hoặc trong các ứng dụng y sinh như sản xuất axít lactobionic (Nyanhongo, et al., 2013).
Trong nghiên cứu này, chúng tôi trình bày một số kết quả sàng lọc hoạt tính CDH của một số chủng nấm phân lập tại Vườn quốc gia Cúc Phương (Ninh Bình) và Mường Phăng (Điện Biên) và lần đầu tiên xác định hoạt tính enzyme này từ loài nấm phân lập Coprinellus aureogranulatus MPG14. 
VẬT LIỆU VÀ PHƯƠNG PHÁP
Vật liệu
Chủng nấm
47 chủng nấm nghiên cứu được phân lập, tinh sạch từ mẫu nấm thu thập tại VQG Cúc Phương (Ninh Bình) và Mương Phăng (Điện Biên). Một số chủng tiềm năng sau khi tinh sạch được định tên bằng phương pháp sinh học phân tử phục vụ cho những nghiên cứu sâu hơn và được lưu giữ tại Phòng Sinh học thực nghiệm, Viện Hóa học các hợp chất thiên nhiên.
Trong số 47 chủng nấm trên thì có 31 chủng đã được định tên theo phương pháp hình thái giải phẫu so sánh, đây là kết quả kế thừa từ các nghiên cứu trước. Danh sách chủng thể hiện ở Bảng 1. 
Môi trường nhân giống
Nấm phát triển trên môi trường thạch PDA (khoai tây 200 g/L, dextrose 20 g/L, agar 17 g/L,
H2O 1 lít), nuôi cấy ở 27oCvà lưu giữ 4oC sau khi khuẩn ty phát triển đầy bề mặt thạch. Để nhân giống cho quá trình sinh tổng hợp enzyme, khuẩn ty nấm từ môi trường thạch được cấy chuyển sang các đĩa môi trường thạch mới, khoảng 1 tuần để nấm phát triển phục vụ cho các nghiên cứu tiếp theo.
Phương pháp nuôi cấy nấm cho sàng lọc enzyme CDH
Nấm được nuôi cấy trên môi trường cơ bản bao gồm các thành phần cần thiết cho sự phát
triển (MgSO4 0,5 g/L, KH2PO4 1,5 g/L, cao nấm men 2 g/L, dịch vi lượng 0,1 lít, pH 7,0) và bổ sung 2% (w/v) cơ chất giàu lignocellulose (rơm). Sau đó được nuôi cấy trong các bình Erlenmeyer 250 mL chứa 75 mL môi trường trong điều kiện lắc liên tục 200 v/ph, ở 25oC. Sau 10 ngày, dịch chiết thô từ môi trường nuôi cấy lỏng được lấy để đánh giá hoạt tính enzyme. Hoạt tính cao nhất trong suốt quá trình nuôi cấy được so sánh giữa các chủng nấm với nhau để lựa chọn chủng có hoạt tính enzyme cao.
Tách chiết và tinh sạch DNA tổng số
DNA tổng số được tách chiết theo protocol CTAB của Doyle (1987) (Doyle, 1987) và điện di trên gel agarose 0,9% (80 - 100 V). Kiểm tra độ sạch và hàm lượng DNA tổng số bằng thiết bị
đo quang phổ ở bước sóng λ = 260 nm và 280 nm. Tinh sạch DNA bằng bộ KIT Fermentas (Thermo Fisher, Waltham, USA) và tiến hành quy trình theo hướng dẫn của nhà sản xuất.
Nhân gen đích bằng kỹ thuật PCR
Nhân vùng gen nhân (ITS) bằng kỹ thuật PCR với cặp mồi ITS1: TCCGTAGGTGAACCTGCGG; ITS4: TCCTCCGCTTATTGATATGC (White, et al., 1990). Thành phần mỗi phản ứng PCR có thể tích 25 μL gồm các thành phần: 13 μL d.H2O, 2,5 μL buffer 10X, 1 μL MgCl2 25 mM, 2,5 μL dNTP 2,5 mM, 1,25 μL mồi xuôi (10 pmol/μL), 1,25 μL mồi ngược (10 pmol/μL), 0,5 μL Taq polymerase (5 U μL), 3 μL DNA (10-20 ng).
Chu trình nhiệt của phản ứng PCR gồm: 94oC trong 3 phút; tiếp sau là 35 chu kỳ nối tiếp nhau với các bước: 94oC trong 45 giây, 55oC trong 45 giây, 72oC trong 45 giây; kết thúc phản ứng nhân gen ở 72oC trong 10 phút, giữ sản phẩm ở 4oC. 
Sản phẩm của PCR được kiểm tra bằng cách chạy điện di trên gel agarose 1,5% và tinh sạch bằng Qiaquick gel extraction kit (Qiagen, Đức). Sản phẩm này được sử dụng làm khuôn cho phản ứng giải trình tự trực tiếp hai chiều (mồi xuôi và mồi ngược) với mồi ITS1/ITS4, sử dụng BigDye terminator cycler v3.1 và đọc kết quả trên hệ thống ABI 3100 Avant Genetic Analyzer (Applied Biosystems, Mỹ).
Trình tự nucleotide của các chủng nấm được so sánh với các trình tự đã có trên Genbank, sử dụng phần mền BLAST trong NCBI (http://www.ncbi.nlm.nih.gov/BLAST). Trình tự DNA sau khi đọc được hiệu chỉnh bằng mắt với sự trợ giúp của phần mền ChromasPro1.7.6 (Technelysium Pty Ltd., Australia) để loại bỏ các vùng tín hiệu nhiễu. Các trình tự phân tích được sắp xếp thẳng hàng bằng phần mền Bioedit v7.0.5.2 (Hall TA, 1999), Clustal W, geneDoc 2.7 (Nicholas, 1997). Các vùng không có khả năng sắp xếp bị loại bỏ trước khi phân tích.
Xác định hoạt độ cellobiose dehydrogenase
Hoạt tính cellobiose dehydrogenase được xác định dựa trên khả năng oxi hóa cơ chất 2,6-dichlorophenolindophenol (DCIP, Sigma) trong hỗn hợp phản ứng. Phản ứng được thực hiện trong tổng thể tích 200 μL chứa 20 μL enzyme, 130 μL đệm sosium acetate 100 mM pH 4,0, 20 μL lactose 300 mM, 20 μL DCIP 3mM,10 μL NaF 80 mM (khử hoạt tính laccase). Dung dịch phản ứng được ủ ở 37oC trong 5 phút và đo kết quả ở bước sóng 520 nm. Một đơn vị hoạt độ enzyme (U) được xác định là 1 μmol DCIP bị oxy hóa mỗi phút ở điều kiện tiêu chuẩn (Westermark, Eriksson, 1974). 
Xác định nồng độ nguồn carbon và nitrogen thích hợp
Để nghiên cứu ảnh hưởng của nồng độ nguồn carbon và nitrogen đến sự sinh tổng hợp enzyme CDH của chủng nấm nghiên cứu, nồng độ carbon và nitrogen sẽ được thay đổi trong môi trường nuôi cấy theo các thí nghiệm: carbon cao (α-cellulose 20 g/L), nitrogen cao (pepton 20 g/L); carbon cao (α-cellulose 20 g/L), nitrogen thấp (pepton 5 g/L); carbon thấp (α-cellulose 5 g/L), nitrogen cao (pepton 20 g/L); carbon thấp (α-cellulose 20 g/L), nitrogen thấp (pepton 5 g/L). Dịch môi trường được đựng trong các bình Erlenmeyer 250 mL chứa 75 mL, khử trùng 121oC, 1atm trong 20 phút, nấm được lên men trong điều kiện lắc liên tục 200 v/ph. Hoạt tính được so sánh trong các thí nghiệm để lựa chọn thời gian lên men, nồng độ carbon và nitrogen thích hợp cho những nghiên cứu tiếp theo. 
Xác định nhiệt độ, pH thích hợp
Chủng nấm nghiên cứu được nuôi cấy trên môi trường cơ bản (pH 7,0) bổ sung nồng độ nguồn carbon và nitrogen thích hợp. Điều chỉnh pH trong khoảng 5 - 8 bằng dịch đệm acetate 100 mM (pH 5-5,5) và đệm phosphate 100 mM (pH 5,5-8). Nhiệt độ được khảo sát bao gồm 23, 25, 28, 32 và 35oC. Dịch enzyme thô từ các mẫu được thu nhận, ly tâm 5.000 v/ph trong 5 phút sau đó xác định hoạt tính enzyme CDH.
KẾT QUẢ VÀ THẢO LUẬN
Sàng lọc chủng nấm có hoạt tính cellobiose dehydrogenase
Khả năng sinh tổng hợp enzyme CDH của 47 chủng nấm được đánh giá qua sự phân giải cơ chất DCIP. Dịch lên men từ các chủng nấm được ly tâm để loại bỏ sinh khối cũng như các thành phần tạp.
Bảng 1. thể hiện kết quả đánh giá hoạt tính CDH của các chủng nấm.
(1) Hoạt tính cellobiose dehydrogenaseđược xác định bằng phương pháp quang phổ (λ=520 nm) qua khả năng oxi hóa cơ chất 2,6-dichlorophenolindophenol.
Hình 1. Hoạt tính cellobiose dehydrogenase được xác định với cơ chất DCIP (Sigma) trên phiến 96 giếng.
Theo số liệu Bảng 1 cho thấy, nhiều loài nấm có khả năng sinh tổng hợp enzyme CDH (33/47 chủng, đạt 70%). Hoạt tính dao động giữa các chủng là từ 8,91 đến 74,4 U/L đối với cơ chất 2,6-dichlorophenolindophenol. Trong đó, có một số chủng biểu hiện hoạt tính cao là P. pygmaea CP4 (58,38 U/L), N. oryzae CP8 (42,35 U/L), Trametes sp. MPN10 (38,68 U/L). Đặc biệt, chủng Coprinellus sp. MPG14 sinh tổng hợp enzyme CDH cao nhất đạt 74,4 U/L. Theo nghiên cứu Tanima và cs. (2008), chủng nấm lớn T. clypeatus có khả năng sinh enzyme CDH cao nhất trên môi trường cellulose là 55,88 U/mL sau 8 ngày lên men ở 30oC, pH 6,5 (Tanima, et al., 2008). Khả năng sinh enzyme CDH cao nhất từ chủng P. chrysosporium 0,8 U/mL (Habu, et al., 1997), S. commune là 0,15 U/mL (Fang, et al., 1999), H. bipapillatum là 9 U/L (Wolfgang, et al., 2001) và S. rolfsii là 7,5 U/mL (Baminger, et al., 2001) cũng đã được nghiên cứu. 
Như vậy, so sánh với kết quả từ một số nghiên cứu nhận thấy, chủng Coprinellus sp. MPG14 có khả năng sinh enzyme CDH cao (74,4 U/L) trên môi trường nuôi cấy lỏng với cơ chất là rơm. Nhằm tăng khả năng sinh tổng hợp enzyme CDH từ chủng nấm này, nghiên cứu tiếp theo sẽ xác định các điều kiện nuôi cấy thích hợp như thời gian, nồng độ nguồn carbon, nitrogen, nhiệt độ và pH.
Định danh nấm bằng phương pháp sinh học phân tử
Các chủng nấm phân lập đều được định danh bằng hình thái giải phẫu và phương pháp sinh học phân tử như mô tả ở phần phương pháp nghiên cứu. Ở đây trình bày chi tiết kết quả phân loại chủng Coprinellus sp. MPG14 biểu hiện hoạt tính CDH cao nhất.
Kết quả kiểm tra DNA tổng số của chủng ký hiệu MPG14 trên gel agarose 1% được thể hiện trong Hình 2. Giếng chỉ cho một băng vạch duy nhất, băng đậm, sắc nét, thể hiện DNA tách chiết được có độ tinh sạch cao. Cặp mồi ITS1/ITS4 đã nhân bản thành công ở nhiệt độ gắn mồi là 55oC. Sản phẩm PCR có kích thước khoảng 700 bp. Chất lượng của sản phẩm PCR được thể hiện khi điện di trên gel agarose 1,5% chỉ có một băng duy nhất, sáng đậm, đủ tiêu chuẩn cho tách đoạn gen nhân để giải mã trình tự nucleotide.
Kết quả xác định trình tự vùng gen nhân (ITS-rDNA) ở chủng nấm MPG14 cho ảnh điện di đồ với các đỉnh huỳnh quang rõ nét, cường độ mạnh và rõ ràng. Sau khi loại bỏ trình tự mồi và các vùng tín hiệu nhiễu, chúng tôi đã thu được trình tự nucleotide và kiểm tra độ tương đồng của trình tự trên ngân hàng gen.
Trình tự được kiểm tra tính tương đồng với các trình tự sẵn có trên ngân hàng Genbank bằng công cụ BLAST. Kết quả tìm kiếm cho thấy trình tự mẫu nấm MPG14 tương đồng cao tương đồng cao 100% với loài Coprinellus aureogranulatus GQ249274.
Hình 2. Điện di DNA tổng số trên gel agarose 1 %(A) và sản phẩm của PCR phân tích với cặp mồi ITS1/ITS4 điện di trên gel agarose 1,5% của chủng MPG 14 (M:marker phân tử 1 kb) (B).
Sơ đồ mối quan hệ di truyền của một số loài thuộc chi Coprinellus đã được xây dựng theo phương pháp ML trên Hình 3. Chủng nấm MPG14 và loài C. aureogranulatus tạo thành một nhóm riêng có mức độ tương đồng di truyền cao (100%) và có quan hệ mật thiết với nhau với giá trị bootstrap 100%. Kết quả này cho phép nhận định chủng nấm MPG14 có chung nguồn gốc với loài C. aureogranulatus trên thế giới.
Điều kiện thích hợp cho lên men sinh tổng hợp enzyme CDH
Ảnh hưởng của nồng độ carbon và nitrogen 
Các chủng nấm phân lập được sàng lọc hoạt tính enzyme CDH trên môi trường rắn với cơ chất rơm trên môi trường cơ bản. Để tăng hiệu suất sinh tổng hợp và tinh sạch enzyme CDH, nghiên cứu tiếp theo sẽ sử dụng cơ chất chất cảm ứng với các nồng độ khác nhau được bổ sung vào môi trường lên men lỏng.
Hình 3. Mối quan hệ họ hàng của chủng nấm MPG14 với các loài/thứ trong cùng chi lấy trên Genbank trên cơ sở phân tích trình tự nucleotide vùng gen ITS-rDNA bằng phương pháp Maximum Likelihood (ML). Các số trên các nhánh tượng trưng cho sự hỗ trợ bootstrap. Psathyrella pygmaea MG734744 được xem như loài ngoài nhóm (outgroup).
Chủng C. aureogranulatus MPN14 được nuôi cấytrên môi trường có bổ sung nguồn carbon từ cơ chất giàu lignocellulose (α-cellulose) và nguồn nitrogen từ pepton với các nồng độ khác nhau trong thời gian từ 3 đến 18 ngày, pH 7,0. Kết quả trên hình 4 cho thấy, nấm sinh tổng hợp enzyme CDH mạnh trên các môi trường với nồng độ nguồn carbon và nitrogen khác nhau. Khả năng sinh tổng hợp enzyme CDH cao nhất (122,6 U/L) sau 12 ngày nuôi cấy trên môi trường sử dụng nguồn carbon cao, nitrogen thấp (CCNT) và hoạt tính thấp nhất (98,2 U/L) trên môi trường với nguồn carbon thấp, nitrogen cao (CTNC). Trong các thí nghiệm, sự sinh tổng hợp enzyme của nấm bắt đầu ngay sau 3 ngày nuôi cấy, tăng mạnh kể từ ngày thứ 9 và bắt đầu giảm ở ngày thứ 15 (Hình 4). Môi trường có nguồn carbon thấp và nitrogen thấp (CTNT) hoạt tính CDH cao nhất ở ngày thứ 15 (107,4 U/L), đối với môi trường với nguồn carbon cao và nitrogen cao (CCNC) hoạt tính enzyme CDH cao nhất ở ngày thứ 12 (111,5 U/L), mẫu đối chứng với thành phần môi trường cơ bản ngày thứ 15 hoạt tính enzyme CDH là 80,8 U/L. Như vậy, môi trường lên men chủng C. aureogranulatus MPN14 với nguồn carbon cao (α-cellulose 20 g/L) và nguồn nitrogen thấp (pepton 5 g/L) là nguồn dinh dưỡng thích hợp cho sự sinh tổng hợp CDH ở ngày nuôi cấy thứ 12. 
Đa số nấm lớn sử dụng nguồn cacbon giàu cellulose đều làm tăng năng suất sinh tổng hợp CDH. Điều này được giải thích do trong các nguồn cacbon, cellulose là hợp chất cao phân tử được cấu tạo từ các liên kết các mắt xích β-Dglucose, để có nguồn đường cung cấp cho quá trình trao đổi năng lượng nấm phải tăng sinh tổng hợp enzyme CDH để phân hủy cơ chất có trong môi trường. Cùng với nguồn cacbon, nitrogen là một trong những yếu tố dinh dưỡng ảnh hưởng rất lớn đến khả năng sinh trưởng và sinh tổng hợp enzyme CDH của nấm. Kết quả cho thấy, nguồn nitrogen từ pepton làm tăng khả năng sinh tổng hợp CDH của nấm ít nhất từ 1,5 lần so với đối chứng.
Hoạt tính CDH từ nấm thuộc ngành Ascomycetes cũng đã được nghiên cứu, khi đó khả năng sinh enzyme CDH cao nhất trên môi trường lên men sử dụng nguôn carbon cao (α-cellulose), nitrogen thấp (pepton) đối với chủng A. strictum, S. thermophilus, G. saubinetiiN.crassa. Mặt khác, trên môi trường sử dụng nguồn carbon cao, nitrogen cao chủng C.atrobrunneum, M. brunneaS. thermophilum sinh tổng hợp enzyme CDH cao nhất. Ngược lại, môi trường sử dụng nguồn carbon thấp, nitrogen thấp hoặc carbon thấp, nitrogen cao hoạt tính enzyme CDH thấp hoặc âm tính (Wolfgang, et al., 2001).
Hình 4. Động học sinh tổng hợp CDH bởi nấm C. aureogranulatus MPN14 trên môi trường bổ sung nồng độ nguồn carbon và nitrogen khác nhau.
Đa số nấm lớn sử dụng nguồn cacbon giàu cellulose đều làm tăng năng suất sinh tổng hợp CDH. Điều này được giải thích do trong các nguồn cacbon, cellulose là hợp chất cao phân tử được cấu tạo từ các liên kết các mắt xích β-Dglucose, để có nguồn đường cung cấp cho quá trình trao đổi năng lượng nấm phải tăng sinh tổng hợp enzyme CDH để phân hủy cơ chất có trong môi trường. Cùng với nguồn cacbon, nitrogen là một trong những yếu tố dinh dưỡng ảnh hưởng rất lớn đến khả năng sinh trưởng và sinh tổng hợp enzyme CDH của nấm. Kết quả cho thấy, nguồn nitrogen từ pepton làm tăng khả năng sinh tổng hợp CDH của nấm ít nhất từ 1,5 lần so với đối chứng.
Hoạt tính CDH từ nấm thuộc ngành Ascomycetes cũng đã được nghiên cứu, khi đó khả năng sinh enzyme CDH cao nhất trên môi trường lên men sử dụng nguôn carbon cao (α-cellulose), nitrogen thấp (pepton) đối với chủng A. strictum, S. thermophilus, G. saubinetiiN. crassa. Mặt khác, trên môi trường sử dụng nguồn carbon cao, nitrogen cao chủng C. atrobrunneum, M. brunnea S. thermophilum sinh tổng hợp enzyme CDH cao nhất. Ngược lại, môi trường sử dụng nguồn carbon thấp, nitrogen thấp hoặc carbon thấp, nitrogen cao hoạt tính enzyme CDH thấp hoặc âm tính (Wolfgang, et al., 2001). 
Ảnh hưởng nhiệt độ
Để xác định nhiệt độ thích hợp cho sự sinh tổng hợp enzyme CDH của nấm C. aureogranulatus MPN14 môi trường lên men được bổ sung nguồn cơ chất α-cellulose (20 g/L), nguồn nitrogen từ pepton (5 g/L), pH 7,0, sau 12 ngày lên men. Kết quả thí nghiệm thể hiện trên Hình 5.
Hình 5. Ảnh hưởng nhiệt độ lên sự sinh tổng enzyme CDH bởi C. aureogranulatus MPN14.
Hình 6. Ảnh hưởng pH lên sự sinh tổng enzyme CDH bởi nấm C. aureogranulatus MPN14.
Sau 12 ngày lên men ở nhiệt độ từ 23 đến 37oC, chủng C. aureogranulatus MPN14 sinh enzyme CDH cao nhất ở 28oC (157,4 U/L) và thấp nhất ở 23oC (57,85 U/L). Trong khoảng nhiệt độ nghiên cứu đến 28oC, khi nhiệt độ tăng thì khả năng sinh enzyme của nấm cũng tăng. Ngoài khoảng nhiệt độ trên sự sinh tổng hợp enzyme của chủng nấm nghiên cứu giảm rõ rệt và khi nhiệt độ tăng lên 37oC hoạt tính enzyme giảm chỉ còn 72,77 U/L. Như vậy, ở 28oC hiệu suất sinh tổng hợp CDH cao nhất từ chủng nấm nghiên cứu. Kết quả trên khá tương đồng với nghiên cứu của Baminger (2001), đối với nấm S. rolfsii sinh enzyme CDH cao nhất ở 30oC trên môi trường lên men lỏng sử dụng nguồn carbon là α-cellulose (42,6 g/L), pH 5 (Baminger, et al., 2001). Nhiệt độ phản ứng ảnh hưởng mạnh mẽ đến sự sinh tổng hợp enzyme của nấm.
Chủng C. aureogranulatus MPN14 có khả năng sinh trưởng và phát triển với pH từ 4,5 đến 8. Tuy nhiên, khả năng sinh enzyme CDH của chúng đều giảm khi pH trong môi trường là axít hay kiềm. Ở pH 5,5 nấm trên sinh tổng hợp CDH cao nhất đạt 237,4 U/L và thấp nhất là 97,9 U/L ở pH 8 sau 12 ngày lên men. Do pH môi trường ảnh hưởng đến độ bền của enzyme sinh ra nên việc lựa chọn đệm pH thích hợp là rất quan trọng. Có những loại enzyme bền trong môi trường axít, nhưng lại có enzyme bền trong môi trường trung tính hoặc kiềm. Chủng T. clypeatus sinh tổng hợp enzyme cao nhất (55,88 U/mL) tại môi trường với pH 6,5. Tuy nhiên, phần lớn enzyme CDH mất hoạt tính tại môi trường lên men nấm có pH <3 (Tanima, et al., 2008). Như vậy, chủng nấm nghiên cứu sinh enzyme CDH cao nhất ở pH 5,5.
KẾT LUẬN
Từ 47 chủng nấm phân lập ở các vùng môi sinh khác nhau, qua sàng lọc hoạt tính CDH cho thấy hoạt tính enzyme này phổ biến trong giới nấm. Theo đó, chủng ký hiệu MPG14 phân lập tại rừng quốc gia Mường Phăng cho hoạt tính CDH cao nhất (74,4 U/L) và được định danh là Coprinellus aureogranulatus MPG14. Trên môi trường lên men lỏng thích hợp có bổ sung nguồn carbon từ α-cellulose (20 g/L), nguồn nitrogen từ pepton (5 g/L) sau 12 ngày lên men dịch thể, ở 28oC, pH 5,5 trong điều kiện nuôi cấy lắc 200 v/ph hoạt tính enzyme đạt 237,4 U/L. Chủng nấm trên có tiềm năng cao trong việc thu nhận enzyme CDH để chuyển hóa các phụ phẩm công-nông nghiệp giàu lignocellulose.
Lời cảm ơn: Nghiên cứu này được tài trợ bởi Quỹ Phát triển khoa học và công nghệ Quốc gia (NAFOSTED), mã số FWO.104.2017.03 và nhiệm vụ KH&CN theo Nghị định thư Việt Nam-CHLB Đức, mã số NĐT.45.GER/18.
TÀI LIỆU THAM KHẢO
Baminger U, Subramaniam SS, Renganathan V, Haltrich D (2001) Purification and characterization of cellobiose dehydrogenase from the plant pathogen Sclerotium (Athelia) rolfsii. Appl Environ Microbiol 67(4): 1766-1774.
Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19:11-15.
Fang J, Huang F, Gao P (1999) Optimization of cellobiose dehydrogenase production by
Schizophyllum commune and effect of the enzyme on kraft pulp bleaching by ligninases. Process Biochem 34(9): 957-961.
Henriksson G, Johansson G, Pettersson G (2000) A critical review of cellobiose dehydrogenases. J Biotechnol 78(2): 93-113. 
http://www.ncbi.nlm.nih.gov/BLAST. 
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids. Symp. Ser 41: 95-98.
Habu N, Igarashi K, Samejima M, Pettersson B, Eriksson KE (1997) Enhanced production of
cellobiose dehydrogenase in cultures of Phanerochaete chrysosporium supplemented with
bovine calf serum. Biotechnol Appl Biochem 26(2): 97-102.
Harreither W, Sygmund C, Augustin M, Mikhail M, Gorton L, HaltrichD, Ludwig R (2001) Melanie
Narciso Catalytic Properties and Classification of Cellobiose Dehydrogenases from Ascomycetes. Appl Environ Microbiol 77(5): 1804–1815.
Morpeth FF (1985) Some properties of cellobiose oxidase from the white-rot fungus Sporotrichum pulverulentum. Biochem J 228(3): 557–564.
Nyanhongo GS, Sygmund C, Ludwig R, Prasetyo EN, Guebitz GM (2013) Synthesis of multifunctional bioresponsive polymers for the management of chronic wounds. J Biomed Mater Res B Appl Biomater 101(5): 882–891.
Nicholas K, Nicholas HG, Nicholas KB, Nicholas HB, Deerfield DW, Nicholas HBJ, Nicolas
HJ, Nicholas KR, Nicholas A, Nicholas H, Gauch H (1997) GeneDoc 2.7: a tool for editing and
annotating multiple sequence alignments.
Peters D (2007) Raw materials. Adv Biochem Eng Biotechnol 105: 1-30.
Palonen H (2004) Role of lignin in the enzymatic hydrolysis of lignocellulose. VTT Biotechnology.
Sachslehner A, Haltrich D, Nidetzky B, Kulbe KD (1997) Production of hemicellulose - and cellulose degrading enzymes by various strains of Sclerotium rolfsii. Appl Biochem Biotechnol 63-65: 189-201.
Saha T, Ghosh D, Mukherjee S, Bose S, MukherjeeM (2008) Cellobiose dehydrogenase production by the mycelial culture of the mushroom Termitomyces clypeatus. Process Biochem 43(6): 634-641. 
Wood JD, Wood PM (1992) Evidence that cellobiose: quinone oxidoreductase from Phanerochaete
chrysosporium is a breakdown product of cellobiose oxidase. Biochim Biophys Acta 1119(1): 90-6.
Westermark U, Eriksson KE, Daasvatn K (1974) Cellobiose: quinone oxidoreductase, a new wooddegrading enzyme from white-rot fungi. Acta Chemica Scandinavica 28b: 209–214.
White T, Bruns T, Lee S, Taylor F, White TJ, Lee SH, Taylor L, Taylor JS (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications. Academic Press, New York, USA, 315–322.
Zamocky M, Ludwig R, Peterbauer C, Hallberg BM, Divne C, Nicholls P, Haltrich D (2006) Cellobiose dehydrogenase-a flavocytochrome from wood-degrading, phytopathogenic and saprotropic fungi. Curr. Protoc. Pept. Sci 7(3): 255–280.

CELLOBIOSE-DEHYDROGENASE PRODUCTION BY SOME FUNGAL SPECIES ISOLATED IN RAIN FORESTS OF NORTHERN VIETNAM
Vu Dinh Giap1, Thai Thi My Hiep1, Do Huu Nghi1
Institute of Natural Products Chemistry, Vietnam Academy of Science and Technology
SUMMARY
Fungal enzymes are well-known as effective in hydrolyze lignocellulose-rich materials. This decomposition process requires many enzymes to participate in a coordinated factor to hydrolyze the polymer structure. Among them, there are some of popular oxidized enzymes such as lignin peroxidase, mangan peroxidase and laccase. Cellobiose dehydrogenase (CDH) is an extracellular enzyme found in various fungi, it was first discovered in 1974 by Westermark in white rot fungus Trametes verscolor and Phanerochaete chrysosporium. The biological role of CDH has been proven to participate in the decomposition of natural polymers such as cellulose, hemicellulose and lignin by generating hydroxyl radical through Fenton reaction. CDH has unique biochemical and catalytic properties that have been used in biosensors to detect cellodextrin, maltose, lactose and diphenol compounds or in biomedical applications such as lactobionic acid production. Therefore, CDH is an important component of the extracellular enzyme system for lignocellulose decomposition. In this study, 47 fungal strains isolated from rainforests of Cuc Phuong and Muong Phang National Parks and screened for CDH activity. Of which, 33 active fungi exhibited CDH activity from 8.89 to 74.4 U/L during growth on solid medium with rice straw as raw substrate. The highest enzyme production was identified for Coprinellus aureogranulatus (MPG14) reach 77.4 U/L on basic medium and its CDH activity of up to 237.4 U/L under optimal condition: supplemented with carbon source of α-cellulose (20 g/L), nitrogen source (5 g/L peptone) incubated for 12 days at 30℃, pH 5.5 and 200 rpm after inoculation. Thus, the fungus has the potential to exploit the CDH enzyme applied in the pretreatment of lignocellulose-rich materials.
Keywords: cellobiose dehydrogenase, cellodextrin, mannodextrin, fenton, lignocellulose degrading enzymes
Vũ Đình Giáp, Thái Thị Mỹ Hiệp, Đỗ Hữu Nghị
Viện Hóa học các hợp chất thiên nhiên, Viện Hàn lâm Khoa học và Công nghệ Việt Nam
Tạp chí Công nghệ Sinh học 18(1): 135-145, 2020
Tổng số lượt truy cập :
  • 1
  • 7
  • 4
  • 5
  • 8
  • 2
  • 0
lên đầu trang